Loading...

Detail Information of piRNA: piR-mmu-30639

General Information
piRBase Id piR-mmu-30639 Accession DQ540981
Organism Mouse Number of methods 3
Sequence CGGGCCGCCGGTGAAATACCACTACTCTCA Number of papers 11
Length 30 Golden piRNA -
Aliases piR-1093; PIR2092;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
16 GSM822763 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
122 N/A 1360 21515829 small RNA hippocampus
225 GSM1528807 12 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 8 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 7 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 14 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 4 25262350 small RNA E16.5 whole testes
347 GSM475281 1 20022248 small RNA testis 
348 GSM3772906 106 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 98 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 195 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 105 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 103 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 90 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 8 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 2 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 18:54698975-54699005:-
Location 2 3:5860708-5860738:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.4684
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.2347
GSM433295 0.4757
GSM475279 0
GSM475280 0
GSM475281 0.0938
GSM678422 0.0531
The Expression of piRNA: piR-mmu-30639
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.