Loading...

Detail Information of piRNA: piR-mmu-3059

General Information
piRBase Id piR-mmu-3059 Accession DQ551625
Organism Mouse Number of methods 3
Sequence TGGAAAGGATGAACGAACTTGGCCTGACC Number of papers 13
Length 29 Golden piRNA -
Aliases piR-19737; PIR12736;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
59 GSM319955 48 18922463 small RNA 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 200 18922463 small RNA 4-6 week ovary
66 GSM509275 71 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 64 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 70 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 65 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 103 20439430 small RNA MVH-/- E16.5 testis
71 GSM509280 145 20439430 small RNA MitoPLD-/- 10 dpp testis
73 N/A 40 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 19 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 7 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 43 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 10 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 7 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 19 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 2 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 32 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 54 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 31 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 15 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 104 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 38 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 25 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 78 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
115 GSM958036 2 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 3 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 4 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
126 GSM466728 3 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 2 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 2 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 4 20059948 Mili IP Tdrd9-/- 14dpp testis
225 GSM1528807 67 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 109 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 140 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 138 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 54 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 142 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 35 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 209 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 377 25262350 small RNA E16.5 whole testes
247 GSM1318060 406 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
348 GSM3772906 1811 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 4479 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 5812 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 4545 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 4487 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 3290 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 1077 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 4028 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 77744 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 2093 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 31158 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 4496 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 569 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 9 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 795 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 11 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 669 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 5 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:130278015-130278044:+ Nop56 ENSMUST00000103198; Nop56 ENSMUST00000150745; Nop56 ENSMUST00000161543; Nop56 ENSMUST00000149955; Nop56 ENSMUST00000146454; Nop56 ENSMUST00000153353; Nop56 ENSMUST00000028890; Nop56 ENSMUST00000150401; Nop56 ENSMUST00000133351; Nop56 ENSMUST00000159373; Nop56 ENSMUST00000145335; Snord57 ENSMUST00000083338; Simple_repeat Simple_repeat (ATAT)n;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 12.6462
GSM433289 31.0612
GSM433290 7.4331
GSM433291 0.7115
GSM433292 6.0782
GSM433293 6.3807
GSM433294 49.0419
GSM433295 34.2485
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 29.8724
The Expression of piRNA: piR-mmu-3059
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.