Loading...

Detail Information of piRNA: piR-mmu-3051

General Information
piRBase Id piR-mmu-3051 Accession DQ696417
Organism Mouse Number of methods 5
Sequence TGGAAAGAGAAGCATGTAGACGAATAGGC Number of papers 13
Length 29 Golden piRNA -
Aliases piR-19730; piR-111739; PIR12729; PIR205065;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 3504 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 4620 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2873 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1463 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 704 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 1570 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 471 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 119 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 63 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 25 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 18 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 22 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 10 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 3 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 7 20439430 small RNA Mili-/- E16.5 testis
121 GSM545783 108 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 2 20059948 Mili IP Tdrd9+/- 14dpp testis
217 GSM1653802 17 25582079 MIWI CLIP round spermatids
225 GSM1528807 652 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 966 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 888 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 822 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 16 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 23 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 20 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 9 26115953 small RNA 25dpp homo tdrd6 KO testes
348 GSM3772906 10 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
441 GSM1096582 16 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 15 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 24 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 14 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 74 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 25 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 182 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 54 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 191 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 60 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 185 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 12:98415098-98415127:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 30.1347
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 3.747
GSM433289 5.031
GSM433290 4.2475
GSM433291 3.2015
GSM433292 8.2664
GSM433293 9.3584
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.3184
The Expression of piRNA: piR-mmu-3051
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.