Loading...

Detail Information of piRNA: piR-mmu-3024

General Information
piRBase Id piR-mmu-3024 Accession DQ695843
Organism Mouse Number of methods 5
Sequence TGGAAACCTGTGCCCTTTGTAGATGCC Number of papers 13
Length 27 Golden piRNA -
Aliases piR-19705; piR-111165; PIR12704; PIR204491;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 4 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 36 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 5 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 24 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 34 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 35 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 1 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 2 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 360 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 221 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
66 GSM509275 3 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 4 20439430 small RNA Mili-/- E16.5 testis
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 4 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 5 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 2 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 2 22902560 Mili IP Tdrd1 -/-,E18,testis
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 79 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 66 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 90 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 136 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 24 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 47 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 52 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 11 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 51 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 782 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 367 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 805 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 916 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 40 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 80 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 162 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 249 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 65 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 55 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:62225952-62225979:- Zfp37 ENSMUST00000212325;
Location 2 4:62233551-62233578:+ SINE B4 RSINE1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 5.6205
GSM433289 10.2808
GSM433290 11.0434
GSM433291 3.913
GSM433292 6.0782
GSM433293 5.9553
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.0531
The Expression of piRNA: piR-mmu-3024
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.