Loading...

Detail Information of piRNA: piR-mmu-3011

General Information
piRBase Id piR-mmu-3011 Accession DQ551581
Organism Mouse Number of methods 4
Sequence TGGAAACAGCTCTGCCGCGAGAAAGACTT Number of papers 12
Length 29 Golden piRNA Y
Aliases piR-19693; PIR12692;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 2406 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2108 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2555 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 2676 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 281 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 210 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 402 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 218 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 35 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 42 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 54 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 11 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 31 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 119 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 14 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 54 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 34 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 12 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 6 20439430 small RNA Mili-/- E16.5 testis
71 GSM509280 2 20439430 small RNA MitoPLD-/- 10 dpp testis
121 GSM545783 250 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 53 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 42 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 213 20022248 Miwi IP adult testis
133 GSM475280 63 20022248 Mili IP adult testis
217 GSM1653802 45 25582079 MIWI CLIP round spermatids
225 GSM1528807 481 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 818 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 728 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 847 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 19 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 75 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 118 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 16 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 213 20022248 Miwi-IP testis 
346 GSM475280 63 20022248 Mili-IP testis 
347 GSM475281 121 20022248 small RNA testis 
441 GSM1096582 31 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 212 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 84 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 176 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 310 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 86 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 189 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 126 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 248 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 137 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 204 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 18:67055409-67055438:- LINE L1 Lx8b;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 53.7455
Sample CPM
GSM400968 7.8157
GSM400969 2.3409
GSM433288 4.4496
GSM433289 16.4056
GSM433290 25.0601
GSM433291 5.6916
GSM433292 28.446
GSM433293 23.396
GSM433294 0
GSM433295 0
GSM475279 20.4592
GSM475280 5.728
GSM475281 11.3513
GSM678422 0.2122
The Expression of piRNA: piR-mmu-3011
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.