Loading...

Detail Information of piRNA: piR-mmu-29125

General Information
piRBase Id piR-mmu-29125 Accession DQ699057
Organism Mouse Number of methods 3
Sequence CCCAATGACGGTGATGTATAATGCTC Number of papers 10
Length 26 Golden piRNA -
Aliases piR-114379; PIR207705;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
50 GSM610965 3 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 6 21602304 small RNA Male germ cell, Pachytene spermatocytes
58 GSM319954 3 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 2 20439430 small RNA Mili-/- E16.5 testis
70 GSM509279 5 20439430 small RNA MVH-/- E16.5 testis
115 GSM958036 3 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
246 GSM1318059 3 25262350 small RNA E16.5 whole testes
247 GSM1318060 4 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
347 GSM475281 1 20022248 small RNA testis 
348 GSM3772906 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 22 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 16 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 17 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
363 GSM2500215 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
Location in GRCm38
1437 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:166764507-166764533:- Gm4954 ENSMUST00000135069; LINE L1 L1MB8;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
The Expression of piRNA: piR-mmu-29125

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.