Loading...

Detail Information of piRNA: piR-mmu-2876

General Information
piRBase Id piR-mmu-2876 Accession DQ551444
Organism Mouse Number of methods 3
Sequence TGCTTGTGTGGTTGCCTGAATCTTAG Number of papers 7
Length 26 Golden piRNA -
Aliases piR-19556; PIR12555;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
57 GSM319953 16 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 15 18922463 Mili IP 10 dpp Dnmt3L KO testis
64 GSM319960 15 18922463 small RNA 10 dpp testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 4 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 7 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 5 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 6 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 3 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
443 GSM1096583 12 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 13 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 51 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 89 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 3 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 4 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 3 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:83355650-83355676:- 1700001L05Rik ENSMUST00000178628;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 12.0605
GSM319954 6.9736
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 7.4862
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.6393
GSM433289 0.4375
GSM433290 1.2742
GSM433291 1.0672
GSM433292 0.2431
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0.1921
GSM475280 0.0909
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-2876
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.