Loading...

Detail Information of piRNA: piR-mmu-287

General Information
piRBase Id piR-mmu-287 Accession DQ539915
Organism Mouse Number of methods 2
Sequence AACATTTCCTGGGCCTTTCAGGAATACCACGA Number of papers 3
Length 32 Golden piRNA -
Aliases piR-27; PIR1026;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
122 N/A 304 21515829 small RNA hippocampus
217 GSM1653802 2 25582079 MIWI CLIP round spermatids
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:24615936-24615968:- Gm29216 ENSMUST00000187117; LINE L1 L1MB2;
Location 2 MT:6609-6641:+ mt-Co1 ENSMUST00000082402;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.