Loading...

Detail Information of piRNA: piR-mmu-2865

General Information
piRBase Id piR-mmu-2865 Accession DQ551434
Organism Mouse Number of methods 3
Sequence TGCTTGGTGACCTCGACCTTGACCCCT Number of papers 9
Length 27 Golden piRNA Y
Aliases piR-19546; PIR12545;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
57 GSM319953 35 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 136 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
60 GSM319956 2 18922463 Mili IP 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 1 18922463 small RNA 4-6 week ovary
72 GSM179088 9 17446352 Mili IP 10 dpp testis
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 3 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 3 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 1 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 2 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 1 22020280 Mili IP wild_type_1 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 56 25262350 small RNA E16.5 whole testes
247 GSM1318060 27 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
443 GSM1096583 2 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 18 23523368 oxidized small RNA Wild Type 12.5 dpp testes
446 GSM1096601 18 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:6614860-6614887:- LTR ERVK IAPLTR3;
piRNA Expression
Sample CPM
GSM179088 49.7873
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 26.3824
GSM319954 63.2278
GSM319955 0.6068
GSM319956 4.2404
GSM319957 0.5154
GSM319958 1.6113
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
The Expression of piRNA: piR-mmu-2865
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.