Loading...
| piRBase Id | piR-mmu-2865 | Accession | DQ551434 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGCTTGGTGACCTCGACCTTGACCCCT | Number of papers | 9 |
| Length | 27 | Golden piRNA | Y |
| Aliases | piR-19546; PIR12545; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 50 | GSM610965 | 1 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
| 57 | GSM319953 | 35 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
| 58 | GSM319954 | 136 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
| 59 | GSM319955 | 1 | 18922463 | small RNA | 16.5 dpc testis |
| 60 | GSM319956 | 2 | 18922463 | Mili IP | 16.5 dpc testis |
| 61 | GSM319957 | 1 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 62 | GSM319958 | 1 | 18922463 | small RNA | 4-6 week ovary |
| 72 | GSM179088 | 9 | 17446352 | Mili IP | 10 dpp testis |
| 73 | N/A | 1 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
| 74 | N/A | 3 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
| 75 | N/A | 3 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
| 76 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_2 E16.5 fetal testis |
| 78 | N/A | 1 | 22020280 | Mili IP | Miwi2+/-_2 E16.5 fetal testis |
| 79 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
| 80 | N/A | 2 | 22020280 | Mili IP | Miwi2-/-_2 E16.5 fetal testis |
| 81 | N/A | 1 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
| 114 | GSM958035 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
| 240 | GSM433294 | 1 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 246 | GSM1318059 | 56 | 25262350 | small RNA | E16.5 whole testes |
| 247 | GSM1318060 | 27 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
| 443 | GSM1096583 | 2 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 18 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 446 | GSM1096601 | 18 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 7:6614860-6614887:- | LTR ERVK IAPLTR3; |
| Sample | CPM |
|---|---|
| GSM179088 | 49.7873 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 26.3824 |
| GSM319954 | 63.2278 |
| GSM319955 | 0.6068 |
| GSM319956 | 4.2404 |
| GSM319957 | 0.5154 |
| GSM319958 | 1.6113 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0.2347 |
| GSM433295 | 0.2378 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 17446352 | Journal | Science. 2007 May 4;316(5825):744-7. |
|---|---|---|---|
| Title | Developmentally regulated piRNA clusters implicate MILI in transposon control. | ||
| Authors | Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||