Loading...

Detail Information of piRNA: piR-mmu-278236

General Information
piRBase Id piR-mmu-278236 Accession N/A
Organism Mouse Number of methods 3
Sequence TGGAACTGCACAAACTGGCTACTGACAAGAA Number of papers 7
Length 31 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
116 GSM958037 164 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 117 22902560 Mili IP Fkbp6 -/-,P10,testis
133 GSM475280 2 20022248 Mili IP adult testis
226 GSM1528808 4 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2 26588211 small RNA Adult testes Asb1 ao34(Het)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
358 GSM4635231 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male; treat: ionizing radiation)
442 GSM1096599 502 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 80 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 174 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 15 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 125 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 19:9984644-9984675:+ Fth1 ENSMUST00000235196; Fth1 ENSMUST00000025563; Fth1 ENSMUST00000237316; Fth1 ENSMUST00000235407; Fth1 ENSMUST00000237465; Fth1 ENSMUST00000235129; Fth1 ENSMUST00000236195; Fth1 ENSMUST00000236403;
Location 2 X:90744684-90744715:- Gm6977 ENSMUST00000121568; LINE L1 L1M3d; Simple_repeat Simple_repeat (GGAAGG)n;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.1818
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-278236
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.