Loading...

Detail Information of piRNA: piR-mmu-2726

General Information
piRBase Id piR-mmu-2726 Accession DQ551308
Organism Mouse Number of methods 2
Sequence TGCTTAAGCAATAGGTCGCTGGCCATTCA Number of papers 7
Length 29 Golden piRNA -
Aliases piR-19420; PIR12419;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 7 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 3 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
69 GSM509278 5 20439430 small RNA Miwi2-/- E16.5 testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 4 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
236 GSM433290 2 26115953 small RNA 25dpp hetero tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 3 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 23 23523368 small RNA Wild Type 14.5 dpp testes
449 GSM1096586 6 23523368 small RNA Wild Type 20.5 dpp testes
Location in GRCm38
500 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 19:13611383-13611412:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0.4247
GSM433291 0
GSM433292 0.2431
GSM433293 0.4254
GSM433294 0.2347
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-2726
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.