Loading...
piRBase Id | piR-mmu-2658 | Accession | DQ551246 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGCTGTGACAGATGTTGGTATAGTTTA | Number of papers | 9 |
Length | 27 | Golden piRNA | - |
Aliases | piR-19358; PIR12357; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
12 | GSM822758 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
16 | GSM822763 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
17 | GSM822764 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
115 | GSM958036 | 1 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
121 | GSM545783 | 1 | 20534472 | Mov10L1 IP | wild type adult testis |
126 | GSM466728 | 1 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
129 | GSM466729 | 1 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
132 | GSM475279 | 5 | 20022248 | Miwi IP | adult testis |
133 | GSM475280 | 30 | 20022248 | Mili IP | adult testis |
225 | GSM1528807 | 54 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 32 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 129 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 109 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 5 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
236 | GSM433290 | 6 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
237 | GSM433291 | 2 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
345 | GSM475279 | 5 | 20022248 | Miwi-IP | testis |
346 | GSM475280 | 30 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 16 | 20022248 | small RNA | testis |
441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
448 | GSM1096602 | 1 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 3 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 4 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
452 | GSM1096604 | 3 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 6:85114793-85114820:- | Gm5878 ENSMUST00000203386; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0.3908 |
GSM400969 | 0 |
GSM433288 | 1.1709 |
GSM433289 | 0 |
GSM433290 | 1.2742 |
GSM433291 | 0.7115 |
GSM433292 | 0.4863 |
GSM433293 | 0.8508 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0.4803 |
GSM475280 | 2.7276 |
GSM475281 | 1.501 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
---|---|---|---|
Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. |
PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
---|---|---|---|
Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |