Loading...

Detail Information of piRNA: piR-mmu-2657

General Information
piRBase Id piR-mmu-2657 Accession DQ551245
Organism Mouse Number of methods 4
Sequence TGCTGTGACAGATGTTGGTATAGTTT Number of papers 9
Length 26 Golden piRNA -
Aliases piR-19357; PIR12356;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
118 GSM958039 2 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
129 GSM466729 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 27 20022248 Mili IP adult testis
217 GSM1653802 4 25582079 MIWI CLIP round spermatids
225 GSM1528807 39 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 30 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 82 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 73 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 9 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 9 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 10 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 9 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 27 20022248 Mili-IP testis 
347 GSM475281 9 20022248 small RNA testis 
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 5 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:85114794-85114820:- Gm5878 ENSMUST00000203386;
piRNA Expression
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 2.1077
GSM433289 1.9687
GSM433290 2.1237
GSM433291 3.2015
GSM433292 1.2156
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 2.4548
GSM475281 0.8443
GSM678422 0
The Expression of piRNA: piR-mmu-2657
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.