Loading...
| piRBase Id | piR-mmu-2657 | Accession | DQ551245 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGCTGTGACAGATGTTGGTATAGTTT | Number of papers | 9 |
| Length | 26 | Golden piRNA | - |
| Aliases | piR-19357; PIR12356; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 118 | GSM958039 | 2 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
| 119 | GSM958040 | 1 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
| 129 | GSM466729 | 1 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 132 | GSM475279 | 1 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 27 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 4 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 39 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 30 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 82 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 73 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 9 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 9 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 10 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 9 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 345 | GSM475279 | 1 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 27 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 9 | 20022248 | small RNA | testis |
| 447 | GSM1096585 | 2 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 1 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 5 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 6:85114794-85114820:- | Gm5878 ENSMUST00000203386; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0.932 |
| Sample | CPM |
|---|---|
| GSM400968 | 0.3908 |
| GSM400969 | 0 |
| GSM433288 | 2.1077 |
| GSM433289 | 1.9687 |
| GSM433290 | 2.1237 |
| GSM433291 | 3.2015 |
| GSM433292 | 1.2156 |
| GSM433293 | 0.8508 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0.0961 |
| GSM475280 | 2.4548 |
| GSM475281 | 0.8443 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
|---|---|---|---|
| Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
| Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||