Loading...

Detail Information of piRNA: piR-mmu-264

General Information
piRBase Id piR-mmu-264 Accession DQ718111
Organism Mouse Number of methods 4
Sequence TGCACGGAAATTATTGAGGCTCCGGT Number of papers 10
Length 26 Golden piRNA Y
Aliases piR-17240; piR-133433; PIR10239; PIR226759;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
51 GSM610966 16 21602304 small RNA Male germ cell, Pachytene spermatocytes
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
121 GSM545783 8 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 6 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 4 20022248 Miwi IP adult testis
133 GSM475280 201 20022248 Mili IP adult testis
225 GSM1528807 23 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 32 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 88 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 49 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 23 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 23 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 31 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 4 20022248 Miwi-IP testis 
346 GSM475280 201 20022248 Mili-IP testis 
347 GSM475281 30 20022248 small RNA testis 
441 GSM1096582 30 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 161 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 76 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 596 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 365 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 73 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 70 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 281 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 240 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 198 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 125 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27324810-27324836:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 3.728
Sample CPM
GSM400968 1.1724
GSM400969 0
GSM433288 5.3864
GSM433289 5.031
GSM433290 6.5836
GSM433291 0.3557
GSM433292 7.2938
GSM433293 11.4853
GSM433294 0
GSM433295 0
GSM475279 0.3842
GSM475280 18.275
GSM475281 2.8144
GSM678422 0
The Expression of piRNA: piR-mmu-264
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.