Loading...

Detail Information of piRNA: piR-mmu-2616

General Information
piRBase Id piR-mmu-2616 Accession DQ551208
Organism Mouse Number of methods 4
Sequence TGCTGGGCTGACCTCATCTCACACGTGC Number of papers 9
Length 28 Golden piRNA -
Aliases piR-19320; PIR12319;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
37 GSM684622 64 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 7 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
72 GSM179088 1 17446352 Mili IP 10 dpp testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 6 20022248 Mili IP adult testis
225 GSM1528807 10 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 8 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 19 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 14 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 16 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 28 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 9 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 6 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
441 GSM1096582 6 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 67 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 34 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 67 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 60 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 6 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 11 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 19 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 21 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 22 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 19 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27327616-27327644:+ Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125;
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.747
GSM433289 6.1247
GSM433290 1.9114
GSM433291 0.7115
GSM433292 4.1332
GSM433293 2.1269
GSM433294 0
GSM433295 0
GSM475279 0.1921
GSM475280 0.5455
GSM475281 0.1876
GSM678422 0
The Expression of piRNA: piR-mmu-2616
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.