Loading...

Detail Information of piRNA: piR-mmu-2609

General Information
piRBase Id piR-mmu-2609 Accession DQ551201
Organism Mouse Number of methods 4
Sequence TGCTGGATAAAGGATTACTCACGGTTAGA Number of papers 13
Length 29 Golden piRNA Y
Aliases piR-19313; PIR12312;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 2165 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 582 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1426 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 1132 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 153 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 318 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 86 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 9 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 4 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 13 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 7 21602304 small RNA Male germ cell, Round spermatids
67 GSM509276 3 20439430 small RNA MitoPLD-/- E16.5 testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
87 N/A 1 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
121 GSM545783 14 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 141 20022248 Miwi IP adult testis
133 GSM475280 20 20022248 Mili IP adult testis
134 N/A N/A 24787618 Miwi CLIP elongating spermatids
217 GSM1653802 12 25582079 MIWI CLIP round spermatids
225 GSM1528807 212 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 371 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 873 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 708 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 4 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 4 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 16 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 141 20022248 Miwi-IP testis 
346 GSM475280 20 20022248 Mili-IP testis 
347 GSM475281 104 20022248 small RNA testis 
441 GSM1096582 13 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 15 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 32 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 207 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 67 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 37 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 78 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 54 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 108 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 81 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:110123482-110123511:+
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.9368
GSM433289 0.875
GSM433290 3.398
GSM433291 0.7115
GSM433292 4.1332
GSM433293 6.3807
GSM433294 0
GSM433295 0
GSM475279 13.5434
GSM475280 1.8184
GSM475281 9.7565
GSM678422 0.1061
The Expression of piRNA: piR-mmu-2609
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Psmd8 NM_026545 deadenylation mm9 chr7:29959385-29959404:- n 24787618
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 24787618 Journal Cell Res. 2014 Jun;24(6):680-700.
Title Pachytene piRNAs instruct massive mRNA elimination during late spermiogenesis.
Authors VGou LT, Dai P, Yang JH, Xue Y, Hu YP, Zhou Y, Kang JY, Wang X, Li H, Hua MM, Zhao S, Hu SD, Wu LG, Shi HJ, Li Y, Fu XD, Qu LH, Wang ED, Liu MF.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.