Loading...

Detail Information of piRNA: piR-mmu-250

General Information
piRBase Id piR-mmu-250 Accession DQ549115
Organism Mouse Number of methods 4
Sequence TGCACATTCGATGTCTACATATTACTGA Number of papers 10
Length 28 Golden piRNA -
Aliases piR-17227; PIR10226;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
34 GSM684627 7 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 2 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
129 GSM466729 2 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 3 20022248 Miwi IP adult testis
133 GSM475280 16 20022248 Mili IP adult testis
225 GSM1528807 35 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 22 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 12 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 5 26588211 small RNA Adult testes Asb1 ao36(KO)
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
345 GSM475279 3 20022248 Miwi-IP testis 
346 GSM475280 16 20022248 Mili-IP testis 
347 GSM475281 8 20022248 small RNA testis 
446 GSM1096601 11 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 3 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113333577-113333605:- LTR ERVK RLTR11A;
piRNA Expression
Sample CPM
GSM400968 2.7355
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0.2124
GSM433291 0
GSM433292 0.2431
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0.2882
GSM475280 1.4547
GSM475281 0.7505
GSM678422 0
The Expression of piRNA: piR-mmu-250
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.