Loading...

Detail Information of piRNA: piR-mmu-248

General Information
piRBase Id piR-mmu-248 Accession DQ549113
Organism Mouse Number of methods 2
Sequence TGCACATTATTGAAGGCCACGAAATCTCC Number of papers 7
Length 29 Golden piRNA -
Aliases piR-17225; PIR10224;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 7 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 12 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 3 20022248 Miwi IP adult testis
133 GSM475280 15 20022248 Mili IP adult testis
225 GSM1528807 2 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 3 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 6 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 2 26588211 small RNA Adult testes Asb1 ao36(KO)
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
345 GSM475279 3 20022248 Miwi-IP testis 
346 GSM475280 15 20022248 Mili-IP testis 
347 GSM475281 1 20022248 small RNA testis 
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:127793507-127793536:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.6213
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 0
GSM433289 0
GSM433290 0.2124
GSM433291 0
GSM433292 0
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0.2882
GSM475280 1.3638
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-248
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ