Loading...

Detail Information of piRNA: piR-mmu-2379

General Information
piRBase Id piR-mmu-2379 Accession DQ550992
Organism Mouse Number of methods 3
Sequence TGCTCAGAGACCGAAGAGATTGAATGGC Number of papers 11
Length 28 Golden piRNA -
Aliases piR-19104; PIR12103;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 15 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 16 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 16 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 25 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 10 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 10 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 3 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
69 GSM509278 4 20439430 small RNA Miwi2-/- E16.5 testis
73 N/A 27 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 11 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 5 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 27 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 20 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 24 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 28 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 9 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 21 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 18 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 2 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
87 N/A 2 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
116 GSM958037 7 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 2 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 14 22902560 Mili IP Tdrd1 -/-,E18,testis
224 GSM1528806 10 26588211 small RNA 10dpp testes
225 GSM1528807 11 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 18 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 17 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 21 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
441 GSM1096582 4 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 10 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 29 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 3 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 61 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 3 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 17 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 2 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 17 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 3 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 9 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:83585794-83585822:+ Gm21284 ENSMUST00000205532; SINE Alu B1_Mur3;
Location 2 6:85990668-85990696:- Gm19265 ENSMUST00000201818;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 2.2613
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 1.3124
GSM433290 0.6371
GSM433291 0
GSM433292 0.2431
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-2379
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.