Loading...

Detail Information of piRNA: piR-mmu-2315

General Information
piRBase Id piR-mmu-2315 Accession DQ550934
Organism Mouse Number of methods 3
Sequence TGCTATGACGAAGTGCCTAAGACTGGG Number of papers 10
Length 27 Golden piRNA -
Aliases piR-19046; PIR12045;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
51 GSM610966 7 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 15 21602304 small RNA Male germ cell, Round spermatids
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 1 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 8 20022248 Miwi IP adult testis
133 GSM475280 14 20022248 Mili IP adult testis
225 GSM1528807 37 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 16 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 24 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 72 26588211 small RNA Adult testes Asb1 ao36(KO)
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 8 20022248 Miwi-IP testis 
346 GSM475280 14 20022248 Mili-IP testis 
347 GSM475281 3 20022248 small RNA testis 
446 GSM1096601 17 23523368 oxidized small RNA Wild Type 14.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:66688097-66688124:- LTR ERV1 MLTR14;
piRNA Expression
Sample CPM
GSM400968 3.1263
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0.3557
GSM433292 0
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0.7684
GSM475280 1.2729
GSM475281 0.2814
GSM678422 0
The Expression of piRNA: piR-mmu-2315
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.