Loading...

Detail Information of piRNA: piR-mmu-2293

General Information
piRBase Id piR-mmu-2293 Accession DQ550914
Organism Mouse Number of methods 2
Sequence TGCTAGTGCCAGGACATCTGCTATTCC Number of papers 3
Length 27 Golden piRNA -
Aliases piR-19026; PIR12025;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 1 20059948 Mili IP Tdrd9+/- 14dpp testis
131 GSM466731 1 20059948 Mili IP Tdrd9-/- 14dpp testis
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:23820676-23820703:+ Srrm2 ENSMUST00000190686; Srrm2 ENSMUST00000088621; Srrm2 ENSMUST00000186914;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-2293
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.