Loading...
piRBase Id | piR-mmu-2275 | Accession | DQ550898 |
---|---|---|---|
Organism | Mouse | Number of methods | 4 |
Sequence | TGCTAGGATAAGCAGCCCGATTTCTGGAC | Number of papers | 9 |
Length | 29 | Golden piRNA | - |
Aliases | piR-19010; PIR12009; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
11 | GSM822760 | 19 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
12 | GSM822758 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 11 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 16 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
15 | GSM822762 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
16 | GSM822763 | 11 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
17 | GSM822764 | 14 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
31 | GSM684624 | 5 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
50 | GSM610965 | 3 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
51 | GSM610966 | 28 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
52 | GSM610967 | 217 | 21602304 | small RNA | Male germ cell, Round spermatids |
116 | GSM958037 | 3 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 4 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
120 | GSM958041 | 3 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
121 | GSM545783 | 1 | 20534472 | Mov10L1 IP | wild type adult testis |
126 | GSM466728 | 2 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
129 | GSM466729 | 5 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
130 | GSM466730 | 4 | 20059948 | Mili IP | Tdrd9-/- 14dpp testis |
131 | GSM466731 | 4 | 20059948 | Mili IP | Tdrd9-/- 14dpp testis |
225 | GSM1528807 | 3 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 9 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 4 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 10 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
442 | GSM1096599 | 76 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
447 | GSM1096585 | 2 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 1 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 3 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 5:136935669-136935698:+ | 4933404O12Rik ENSMUST00000181045; 4933404O12Rik ENSMUST00000181190; | SINE B2 B2_Mm1a; |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
---|---|---|---|
Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. |
PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
---|---|---|---|
Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |