Loading...

Detail Information of piRNA: piR-mmu-2275

General Information
piRBase Id piR-mmu-2275 Accession DQ550898
Organism Mouse Number of methods 4
Sequence TGCTAGGATAAGCAGCCCGATTTCTGGAC Number of papers 9
Length 29 Golden piRNA -
Aliases piR-19010; PIR12009;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 19 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 11 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 16 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 11 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 14 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 5 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 3 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 28 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 217 21602304 small RNA Male germ cell, Round spermatids
116 GSM958037 3 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 3 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 5 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 4 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 4 20059948 Mili IP Tdrd9-/- 14dpp testis
225 GSM1528807 3 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 9 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 4 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 10 26588211 small RNA Adult testes Asb1 ao36(KO)
442 GSM1096599 76 23523368 oxidized small RNA Wild Type 10.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 3 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:136935669-136935698:+ 4933404O12Rik ENSMUST00000181045; 4933404O12Rik ENSMUST00000181190; SINE B2 B2_Mm1a;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.