Loading...

Detail Information of piRNA: piR-mmu-227263

General Information
piRBase Id piR-mmu-227263 Accession N/A
Organism Mouse Number of methods 3
Sequence AAGAACTCAAGAAGGTGGACTCCAGAAA Number of papers 11
Length 28 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 30 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 12 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 4 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 6 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 3 18922463 small RNA 16.5 dpc testis
61 GSM319957 14 18922463 Miwi2 IP 16.5 dpc testis
66 GSM509275 92 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 6 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 26 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 2 20439430 small RNA MVH-/- E16.5 testis
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
81 N/A 3 22020280 Mili IP wild_type_1 E16.5 fetal testis
84 N/A 1 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 3 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 6 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 7 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 9 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 9 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 75 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 63 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 138 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
224 GSM1528806 27 26588211 small RNA 10dpp testes
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 3 25262350 small RNA E16.5 whole testes
348 GSM3772906 14 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 11 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 9 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 570 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 24 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 84 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 21 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 93 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
6240 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 3:71458957-71458985:+ Low_complexity Low_complexity A-rich; Low_complexity Low_complexity GA-rich; LINE L1 Lx3B;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 4.5227
GSM319954 0.4649
GSM319955 1.8204
GSM319956 0
GSM319957 7.2153
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.4684
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.2347
GSM433295 0.2378
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-227263
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.