Loading...

Detail Information of piRNA: piR-mmu-226841

General Information
piRBase Id piR-mmu-226841 Accession N/A
Organism Mouse Number of methods 4
Sequence AACGAACGAGACTCTGGCATGCTAACTAGT Number of papers 13
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 15 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
16 GSM822763 77 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 23 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
62 GSM319958 1 18922463 small RNA 4-6 week ovary
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 2 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 24 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 28 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 8 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 4 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 1 20059948 Mili IP Tdrd9-/- 14dpp testis
133 GSM475280 1 20022248 Mili IP adult testis
217 GSM1653802 23 25582079 MIWI CLIP round spermatids
224 GSM1528806 34 26588211 small RNA 10dpp testes
225 GSM1528807 7 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 3 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 15 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 75 25262350 small RNA E16.5 whole testes
247 GSM1318060 60 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
346 GSM475280 1 20022248 Mili-IP testis 
348 GSM3772906 10 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 13 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 2 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
443 GSM1096583 7 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 32 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 15 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 139 23523368 oxidized small RNA Wild Type 14.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:39847736-39847766:+ CT010467.1 ENSMUST00000198477; LINE L1 L1MdV_II;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 1.6441
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 1.6113
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 1.5533
Sample CPM
GSM400968 0
GSM400969 14.0454
GSM433288 0
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0.2378
GSM475279 0
GSM475280 0.0909
GSM475281 0
GSM678422 0.3184
The Expression of piRNA: piR-mmu-226841
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.