Loading...

Detail Information of piRNA: piR-mmu-2195

General Information
piRBase Id piR-mmu-2195 Accession DQ687198
Organism Mouse Number of methods 5
Sequence TGCTAAGCTTCCAGGAATTTTGCATTCCC Number of papers 9
Length 29 Golden piRNA -
Aliases piR-18937; piR-102520; PIR11936; PIR195846;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
50 GSM610965 4 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 29 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 9 21602304 small RNA Male germ cell, Round spermatids
61 GSM319957 2 18922463 Miwi2 IP 16.5 dpc testis
217 GSM1653802 49 25582079 MIWI CLIP round spermatids
225 GSM1528807 135 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 143 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 201 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 178 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 46 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 23 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 42 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 18 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
443 GSM1096583 13 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 15 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 29 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 12 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 11 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 18 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 15 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
36 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 JH584293.1:87524-87553:+ CR974586.5 ENSMUST00000178723;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 1.0308
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 10.7727
GSM433289 5.031
GSM433290 8.9197
GSM433291 6.4031
GSM433292 8.7526
GSM433293 21.2691
GSM433294 0.2347
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-2195
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.