Loading...

Detail Information of piRNA: piR-mmu-2194

General Information
piRBase Id piR-mmu-2194 Accession DQ550824
Organism Mouse Number of methods 3
Sequence TGCTAAGCTTCCAGGAATTTTGCATT Number of papers 11
Length 26 Golden piRNA Y
Aliases piR-18936; PIR11935;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 21 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
50 GSM610965 22 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 172 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 82 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
59 GSM319955 3 18922463 small RNA 16.5 dpc testis
61 GSM319957 5 18922463 Miwi2 IP 16.5 dpc testis
63 GSM319959 2 18922463 small RNA 2 dpp testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 12 22902560 Mili IP Fkbp6 -/-,P0,testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
120 GSM958041 146 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 27 20022248 Miwi IP adult testis
133 GSM475280 119 20022248 Mili IP adult testis
225 GSM1528807 12 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 13 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 25 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 20 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 13 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 6 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 7 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 7 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 5 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
345 GSM475279 27 20022248 Miwi-IP testis 
346 GSM475280 119 20022248 Mili-IP testis 
347 GSM475281 24 20022248 small RNA testis 
443 GSM1096583 3 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 17 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 7 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 3 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
36 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:42246267-42246293:- Gm50470 ENSMUST00000238732;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 1.8204
GSM319956 0
GSM319957 2.5769
GSM319958 0
GSM319959 1.366
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.0445
GSM433289 1.3124
GSM433290 1.4866
GSM433291 2.4901
GSM433292 0.2431
GSM433293 0.8508
GSM433294 1.1733
GSM433295 0.4757
GSM475279 2.5934
GSM475280 10.8195
GSM475281 2.2515
GSM678422 0
The Expression of piRNA: piR-mmu-2194
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.