Loading...

Detail Information of piRNA: piR-mmu-216307

General Information
piRBase Id piR-mmu-216307 Accession N/A
Organism Mouse Number of methods 4
Sequence TGGAACTGCACAAACTGGCTACTGACAAG Number of papers 10
Length 29 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
16 GSM822763 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
37 GSM684622 20 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 4 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 5 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
114 GSM958035 17 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 37 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 671 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 448 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 117 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 17 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 8 20022248 Mili IP adult testis
224 GSM1528806 66 26588211 small RNA 10dpp testes
225 GSM1528807 7 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 16 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 11 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 7 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 8 20022248 Mili-IP testis 
347 GSM475281 4 20022248 small RNA testis 
356 GSM4635229 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
441 GSM1096582 7 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 3711 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 548 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 3390 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 305 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1513 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 11 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 6 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 20 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 7 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 19:9984644-9984673:+ Fth1 ENSMUST00000235196; Fth1 ENSMUST00000025563; Fth1 ENSMUST00000237316; Fth1 ENSMUST00000235407; Fth1 ENSMUST00000237465; Fth1 ENSMUST00000235129; Fth1 ENSMUST00000236195; Fth1 ENSMUST00000236403;
Location 2 X:90744686-90744715:- Gm6977 ENSMUST00000121568; LINE L1 L1M3d; Simple_repeat Simple_repeat (GGAAGG)n;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.4375
GSM433290 0
GSM433291 0
GSM433292 0.2431
GSM433293 0.4254
GSM433294 0
GSM433295 0.2378
GSM475279 0.1921
GSM475280 0.7274
GSM475281 0.3753
GSM678422 0
The Expression of piRNA: piR-mmu-216307
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.