Loading...

Detail Information of piRNA: piR-mmu-216

General Information
piRBase Id piR-mmu-216 Accession DQ549084
Organism Mouse Number of methods 4
Sequence TGCACAGGTCAGGTGGAGTGGATGG Number of papers 11
Length 25 Golden piRNA -
Aliases piR-17196; PIR10195;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
35 GSM684620 45 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 153 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 14 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 10 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 17 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 2 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 2 20439430 small RNA Mili-/- E16.5 testis
121 GSM545783 122 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 13 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 16 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 28 20022248 Mili IP adult testis
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 15 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 13 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 20 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 33 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 8 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 21 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 10 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 28 20022248 Mili-IP testis 
347 GSM475281 14 20022248 small RNA testis 
441 GSM1096582 8 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 43 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 55 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 67 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 131 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 12 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 26 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 47 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 112 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 33 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 47 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:92593207-92593232:+ LTR ERVK ERVB3_1-I_MM;
piRNA Expression
Sample CPM
GSM400968 9.7697
GSM400969 2.3409
GSM433288 1.8735
GSM433289 4.5936
GSM433290 2.1237
GSM433291 0.7115
GSM433292 1.2156
GSM433293 1.7015
GSM433294 0
GSM433295 0
GSM475279 0.1921
GSM475280 2.5458
GSM475281 1.3134
GSM678422 0
The Expression of piRNA: piR-mmu-216
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.