Loading...
piRBase Id | piR-mmu-2145 | Accession | DQ550765 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGCGGGATGCCTGGGTGACGCGATCTGCCCG | Number of papers | 9 |
Length | 31 | Golden piRNA | - |
Aliases | piR-18877; PIR11876; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
50 | GSM610965 | 51 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
52 | GSM610967 | 3 | 21602304 | small RNA | Male germ cell, Round spermatids |
59 | GSM319955 | 5 | 18922463 | small RNA | 16.5 dpc testis |
61 | GSM319957 | 3 | 18922463 | Miwi2 IP | 16.5 dpc testis |
122 | N/A | 118 | 21515829 | small RNA | hippocampus |
217 | GSM1653802 | 3 | 25582079 | MIWI CLIP | round spermatids |
225 | GSM1528807 | 17 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 12 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 10 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 16 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 4 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 7 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 1 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
240 | GSM433294 | 3 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
246 | GSM1318059 | 1 | 25262350 | small RNA | E16.5 whole testes |
247 | GSM1318060 | 1 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
443 | GSM1096583 | 6 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 1 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
449 | GSM1096586 | 1 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 5 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 15:83149763-83149794:+ | Rnu12 ENSMUST00000083242; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 1.6441 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 3.0341 |
GSM319956 | 0 |
GSM319957 | 1.5461 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0.9368 |
GSM433289 | 1.5312 |
GSM433290 | 0.2124 |
GSM433291 | 0 |
GSM433292 | 1.2156 |
GSM433293 | 0.8508 |
GSM433294 | 0.704 |
GSM433295 | 1.6649 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0.0531 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 21515829 | Journal | RNA. 2011 Jun;17(6):1090-9. |
---|---|---|---|
Title | Identification of piRNAs in the central nervous system. | ||
Authors | Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
---|---|---|---|
Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |