Loading...

Detail Information of piRNA: piR-mmu-2145

General Information
piRBase Id piR-mmu-2145 Accession DQ550765
Organism Mouse Number of methods 3
Sequence TGCGGGATGCCTGGGTGACGCGATCTGCCCG Number of papers 9
Length 31 Golden piRNA -
Aliases piR-18877; PIR11876;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 51 21602304 small RNA Male germ cell, Type A spermatogonia
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 5 18922463 small RNA 16.5 dpc testis
61 GSM319957 3 18922463 Miwi2 IP 16.5 dpc testis
122 N/A 118 21515829 small RNA hippocampus
217 GSM1653802 3 25582079 MIWI CLIP round spermatids
225 GSM1528807 17 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 12 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 10 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 16 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 4 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 7 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
240 GSM433294 3 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
443 GSM1096583 6 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 5 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:83149763-83149794:+ Rnu12 ENSMUST00000083242;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.9368
GSM433289 1.5312
GSM433290 0.2124
GSM433291 0
GSM433292 1.2156
GSM433293 0.8508
GSM433294 0.704
GSM433295 1.6649
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.0531
The Expression of piRNA: piR-mmu-2145
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.