Loading...

Detail Information of piRNA: piR-mmu-213655

General Information
piRBase Id piR-mmu-213655 Accession N/A
Organism Mouse Number of methods 4
Sequence TGAGATCCAACTGTAAGGCATTTTCTCA Number of papers 12
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 104 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 25 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 37 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 8 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
35 GSM684620 2 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 1073 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 210 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 304 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 8 18922463 small RNA 16.5 dpc testis
61 GSM319957 20 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 1 18922463 small RNA 4-6 week ovary
66 GSM509275 159 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 151 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 422 20439430 small RNA Miwi2-/- E16.5 testis
70 GSM509279 20 20439430 small RNA MVH-/- E16.5 testis
73 N/A 18 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 3 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 2 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 15 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
78 N/A 3 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 3 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 5 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 3 22020280 Mili IP wild_type_2 E16.5 fetal testis
84 N/A 1 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 3 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 4 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 3 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 13 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 113 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 96 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 8673 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 2272 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 113 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 146 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 1544 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 10 20022248 Mili IP adult testis
224 GSM1528806 923 26588211 small RNA 10dpp testes
225 GSM1528807 7 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 3 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 20 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 20 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 18 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 9 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 5 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 22 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 11 25262350 small RNA E16.5 whole testes
247 GSM1318060 2 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 10 20022248 Mili-IP testis 
347 GSM475281 4 20022248 small RNA testis 
441 GSM1096582 18 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 242 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 59 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 126 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 308 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 466 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 9 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 8 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 10 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 12 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
4624 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 X:12882478-12882506:- SINE B2 B2_Mm2;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.2154
GSM433289 1.9687
GSM433290 1.0619
GSM433291 1.4229
GSM433292 0.9725
GSM433293 2.1269
GSM433294 5.1623
GSM433295 2.6162
GSM475279 0.0961
GSM475280 0.9092
GSM475281 0.3753
GSM678422 0
The Expression of piRNA: piR-mmu-213655
Loading...

P value calculation
Sample1
Sample2
Target mRNA
Target gene Target trans Mechanism Target site Verified PubMed
Hmmr NM_013552 cleavage mm9 chr11:40515856-40515876:- n 25582079
Target lncRNA
No record.
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.