Loading...

Detail Information of piRNA: piR-mmu-213

General Information
piRBase Id piR-mmu-213 Accession DQ549081
Organism Mouse Number of methods 3
Sequence TGCACAGGACTAACTTTTGGCCGAAAGGG Number of papers 5
Length 29 Golden piRNA -
Aliases piR-17193; PIR10192;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
228 GSM1528810 2 26588211 small RNA Adult testes Asb1 ao36(KO)
444 GSM1096600 7 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:57357248-57357277:- LTR ERVK RLTR25B;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.