Loading...

Detail Information of piRNA: piR-mmu-2129

General Information
piRBase Id piR-mmu-2129 Accession DQ550750
Organism Mouse Number of methods 3
Sequence TGCGGAAGGAGAATCATGTTCAGGAA Number of papers 5
Length 26 Golden piRNA -
Aliases piR-18862; PIR11861;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 2 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
126 GSM466728 3 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 1 20059948 Mili IP Tdrd9+/- 14dpp testis
443 GSM1096583 2 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 9 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 3 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 25 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 11:106055709-106055735:+ Dcaf7 ENSMUST00000058438;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0.4649
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-2129
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.