Loading...

Detail Information of piRNA: piR-mmu-2126

General Information
piRBase Id piR-mmu-2126 Accession DQ550748
Organism Mouse Number of methods 3
Sequence TGCGCTTGTGTTTCTGGGAACCTCACA Number of papers 10
Length 27 Golden piRNA -
Aliases piR-18860; PIR11859;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
57 GSM319953 9 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 17 18922463 Mili IP 10 dpp Dnmt3L KO testis
62 GSM319958 1 18922463 small RNA 4-6 week ovary
73 N/A 24 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 8 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 16 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 25 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 12 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 8 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 6 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
80 N/A 1 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
81 N/A 14 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 13 22020280 Mili IP wild_type_2 E16.5 fetal testis
85 N/A 2 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 3 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
129 GSM466729 4 20059948 Mili IP Tdrd9+/- 14dpp testis
133 GSM475280 1 20022248 Mili IP adult testis
224 GSM1528806 3 26588211 small RNA 10dpp testes
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
236 GSM433290 2 26115953 small RNA 25dpp hetero tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
346 GSM475280 1 20022248 Mili-IP testis 
348 GSM3772906 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 6 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 6 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 9 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 10 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
442 GSM1096599 286 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 9 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 27 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 15 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 35 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:117208361-117208388:+ Gan ENSMUST00000162997;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 6.784
GSM319954 7.9035
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 1.6113
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0.4247
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.2347
GSM433295 0.4757
GSM475279 0
GSM475280 0.0909
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-2126
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.