Loading...

Detail Information of piRNA: piR-mmu-2119

General Information
piRBase Id piR-mmu-2119 Accession DQ550741
Organism Mouse Number of methods 1
Sequence TGCGCTATGCCGATCGGGTGTCCGCA Number of papers 4
Length 26 Golden piRNA -
Aliases piR-18853; PIR11852;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
62 GSM319958 1 18922463 small RNA 4-6 week ovary
63 GSM319959 1 18922463 small RNA 2 dpp testis
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
347 GSM475281 1 20022248 small RNA testis 
Location in GRCm38
3 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 12:69159383-69159409:+ Rn7s1 ENSMUST00000174924; SINE MIR MIR;
Location 2 12:69361366-69361392:- Rn7s2 ENSMUST00000175032;
Location 3 6:69516427-69516453:+ Rn7s6 ENSMUST00000175005; LINE L1 L1MdMus_I;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 1.6113
GSM319959 0.683
GSM319960 0
GSM319961 2.0518
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-2119
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.