Loading...

Detail Information of piRNA: piR-mmu-20577

General Information
piRBase Id piR-mmu-20577 Accession DQ691080
Organism Mouse Number of methods 4
Sequence TAGGCTTTGAGGGTGCGATGCGCACGCT Number of papers 13
Length 28 Golden piRNA Y
Aliases piR-106402; PIR199728;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
50 GSM610965 7 21602304 small RNA Male germ cell, Type A spermatogonia
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 13 18922463 small RNA 16.5 dpc testis
61 GSM319957 76 18922463 Miwi2 IP 16.5 dpc testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 2 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
120 GSM958041 7 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
225 GSM1528807 10 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 8 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 5 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 3 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 18 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 10 25262350 small RNA E16.5 whole testes
247 GSM1318060 2 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
348 GSM3772906 27 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 44 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 83 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 104 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 106 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 60 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
360 GSM2500212 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
362 GSM2500214 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
363 GSM2500215 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
364 GSM2500216 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
365 GSM2500217 N/A 31358756 samll RNA(CAS-seq) oocyte(age: 8 to 10 weeks old, female mice; B6D2F1)
444 GSM1096600 6 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 2 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 7 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 1 23523368 small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1126 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:46383443-46383471:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
The Expression of piRNA: piR-mmu-20577
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.