Loading...

Detail Information of piRNA: piR-mmu-203

General Information
piRBase Id piR-mmu-203 Accession DQ549072
Organism Mouse Number of methods 3
Sequence TGCACACGTTTATTGGGAAAGCTTGATT Number of papers 6
Length 28 Golden piRNA -
Aliases piR-17184; PIR10183;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
76 N/A 1 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
85 N/A 2 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
225 GSM1528807 2 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 4 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 8 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 5 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 3 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 2 26115953 small RNA 25dpp hetero tdrd6 KO testes
443 GSM1096583 9 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 7 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
19 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 16:76917769-76917797:- 1700041M19Rik ENSMUST00000208105; LTR ERVK IAPEz-int;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0.6068
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.7026
GSM433289 0.4375
GSM433290 0.4247
GSM433291 0
GSM433292 0.4863
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-203
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.