Loading...
| piRBase Id | piR-mmu-203 | Accession | DQ549072 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGCACACGTTTATTGGGAAAGCTTGATT | Number of papers | 6 |
| Length | 28 | Golden piRNA | - |
| Aliases | piR-17184; PIR10183; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 59 | GSM319955 | 1 | 18922463 | small RNA | 16.5 dpc testis |
| 76 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_2 E16.5 fetal testis |
| 85 | N/A | 2 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
| 225 | GSM1528807 | 2 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 4 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 8 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 5 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 3 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 2 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 2 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 443 | GSM1096583 | 9 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 7 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 2 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 1 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 16:76917769-76917797:- | 1700041M19Rik ENSMUST00000208105; | LTR ERVK IAPEz-int; |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0.6068 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.7026 |
| GSM433289 | 0.4375 |
| GSM433290 | 0.4247 |
| GSM433291 | 0 |
| GSM433292 | 0.4863 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||