Loading...
piRBase Id | piR-mmu-2021 | Accession | DQ550652 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGCCTTTCCTGTGAACGTCAGCTCGGC | Number of papers | 5 |
Length | 27 | Golden piRNA | - |
Aliases | piR-18764; PIR11763; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
75 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
86 | N/A | 1 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
114 | GSM958035 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
115 | GSM958036 | 2 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
116 | GSM958037 | 3 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 2 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
224 | GSM1528806 | 6 | 26588211 | small RNA | 10dpp testes |
441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
442 | GSM1096599 | 50 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
444 | GSM1096600 | 1 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 1 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 1 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 2:32473474-32473501:+ | ||
Location 2 | 4:147202695-147202722:+ | LTR ERV1 RMER5; | |
Location 3 | 4:147209512-147209539:+ |
No record. |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |