Loading...

Detail Information of piRNA: piR-mmu-2021

General Information
piRBase Id piR-mmu-2021 Accession DQ550652
Organism Mouse Number of methods 3
Sequence TGCCTTTCCTGTGAACGTCAGCTCGGC Number of papers 5
Length 27 Golden piRNA -
Aliases piR-18764; PIR11763;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 2 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 3 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 2 22902560 Mili IP Fkbp6 -/-,P10,testis
224 GSM1528806 6 26588211 small RNA 10dpp testes
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 50 23523368 oxidized small RNA Wild Type 10.5 dpp testes
444 GSM1096600 1 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
3 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:32473474-32473501:+
Location 2 4:147202695-147202722:+ LTR ERV1 RMER5;
Location 3 4:147209512-147209539:+
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.