Loading...
piRBase Id | piR-mmu-2020 | Accession | DQ550651 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGCCTTTCACAGTTGGCCCAGAGACTAGA | Number of papers | 8 |
Length | 29 | Golden piRNA | - |
Aliases | piR-18763; PIR11762; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
12 | GSM822758 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
51 | GSM610966 | 3 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
52 | GSM610967 | 15 | 21602304 | small RNA | Male germ cell, Round spermatids |
88 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
132 | GSM475279 | 7 | 20022248 | Miwi IP | adult testis |
133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
217 | GSM1653802 | 16 | 25582079 | MIWI CLIP | round spermatids |
225 | GSM1528807 | 18 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 45 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 10 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 24 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
236 | GSM433290 | 7 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
345 | GSM475279 | 7 | 20022248 | Miwi-IP | testis |
346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 12 | 20022248 | small RNA | testis |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 8:117210608-117210637:+ | Gan ENSMUST00000162997; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 1.4866 |
GSM433291 | 0 |
GSM433292 | 0.7294 |
GSM433293 | 0.4254 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0.6724 |
GSM475280 | 0.0909 |
GSM475281 | 1.1258 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |