Loading...
piRBase Id | piR-mmu-1951 | Accession | DQ540059 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | ACGGTAACGCAGGTGTCCTAAGGCGA | Number of papers | 7 |
Length | 26 | Golden piRNA | - |
Aliases | piR-171; PIR1170; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
72 | GSM179088 | 2 | 17446352 | Mili IP | 10 dpp testis |
73 | N/A | 3 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
74 | N/A | 28 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
75 | N/A | 2 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
76 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_2 E16.5 fetal testis |
77 | N/A | 2 | 22020280 | Mili IP | Miwi2+/-_1 E16.5 fetal testis |
78 | N/A | 1 | 22020280 | Mili IP | Miwi2+/-_2 E16.5 fetal testis |
79 | N/A | 3 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
81 | N/A | 10 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
82 | N/A | 1 | 22020280 | Mili IP | wild_type_2 E16.5 fetal testis |
83 | N/A | 7 | 22020280 | Miwi2 IP | MiliDAH_1 E16.5 fetal testis |
84 | N/A | 3 | 22020280 | Miwi2 IP | MiliDAH_2 E16.5 fetal testis |
85 | N/A | 5 | 22020280 | Miwi2 IP | Miwi2DAH_1 E16.5 fetal testis |
86 | N/A | 11 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
87 | N/A | 11 | 22020280 | Miwi2 IP | wild_type_1 E16.5 fetal testis |
88 | N/A | 3 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
133 | GSM475280 | 12 | 20022248 | Mili IP | adult testis |
224 | GSM1528806 | 65 | 26588211 | small RNA | 10dpp testes |
225 | GSM1528807 | 57 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 52 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 65 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 123 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
246 | GSM1318059 | 2 | 25262350 | small RNA | E16.5 whole testes |
346 | GSM475280 | 12 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 2 | 20022248 | small RNA | testis |
442 | GSM1096599 | 110 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
444 | GSM1096600 | 14 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 5 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 40 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 16:17222383-17222409:+ | ||
Location 2 | 7:130834536-130834562:+ | Fgfr2 ENSMUST00000124096; | LINE L1 Lx3C; |
Sample | CPM |
---|---|
GSM179088 | 11.0638 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 1.091 |
GSM475281 | 0.1876 |
GSM678422 | 0.0531 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 17446352 | Journal | Science. 2007 May 4;316(5825):744-7. |
---|---|---|---|
Title | Developmentally regulated piRNA clusters implicate MILI in transposon control. | ||
Authors | Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
---|---|---|---|
Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |