Loading...

Detail Information of piRNA: piR-mmu-1951

General Information
piRBase Id piR-mmu-1951 Accession DQ540059
Organism Mouse Number of methods 3
Sequence ACGGTAACGCAGGTGTCCTAAGGCGA Number of papers 7
Length 26 Golden piRNA -
Aliases piR-171; PIR1170;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
72 GSM179088 2 17446352 Mili IP 10 dpp testis
73 N/A 3 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 28 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 2 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 1 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 2 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 3 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 10 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 1 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 7 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 3 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 5 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 11 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 11 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 3 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
133 GSM475280 12 20022248 Mili IP adult testis
224 GSM1528806 65 26588211 small RNA 10dpp testes
225 GSM1528807 57 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 52 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 65 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 123 26588211 small RNA Adult testes Asb1 ao36(KO)
246 GSM1318059 2 25262350 small RNA E16.5 whole testes
346 GSM475280 12 20022248 Mili-IP testis 
347 GSM475281 2 20022248 small RNA testis 
442 GSM1096599 110 23523368 oxidized small RNA Wild Type 10.5 dpp testes
444 GSM1096600 14 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 5 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 40 23523368 oxidized small RNA Wild Type 14.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
2 best hit(s) with 1 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 16:17222383-17222409:+
Location 2 7:130834536-130834562:+ Fgfr2 ENSMUST00000124096; LINE L1 Lx3C;
piRNA Expression
Sample CPM
GSM179088 11.0638
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 1.091
GSM475281 0.1876
GSM678422 0.0531
The Expression of piRNA: piR-mmu-1951
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.