Loading...

Detail Information of piRNA: piR-mmu-1940

General Information
piRBase Id piR-mmu-1940 Accession DQ540058
Organism Mouse Number of methods 3
Sequence ACGGGAAACCTCACCCGGCCCGGACAC Number of papers 11
Length 27 Golden piRNA -
Aliases piR-170; PIR1169;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 2 21602304 small RNA Male germ cell, Type A spermatogonia
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
115 GSM958036 6 22902560 Mili IP Fkbp6 -/-,P0,testis
117 GSM958038 20 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 3 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 4 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
126 GSM466728 3 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 4 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 1 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 3 20059948 Mili IP Tdrd9-/- 14dpp testis
225 GSM1528807 9 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 5 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 37 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 45 26588211 small RNA Adult testes Asb1 ao36(KO)
238 GSM433292 1 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 4 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 2 25262350 small RNA E16.5 whole testes
247 GSM1318060 4 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
347 GSM475281 25 20022248 small RNA testis 
443 GSM1096583 22 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 1 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 6 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 75 23523368 oxidized small RNA Wild Type 14.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:39847611-39847638:+ CT010467.1 ENSMUST00000198477;
piRNA Expression
The Expression of piRNA: piR-mmu-1940
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.