Loading...

Detail Information of piRNA: piR-mmu-192238

General Information
piRBase Id piR-mmu-192238 Accession N/A
Organism Mouse Number of methods 4
Sequence AACGAAAGTCGGAGGTTCGAAGACGATC Number of papers 16
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 10 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 1 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 5 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
61 GSM319957 2 18922463 Miwi2 IP 16.5 dpc testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
73 N/A 31 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 6 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 9 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 12 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 4 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
81 N/A 68 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 11 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 8 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 11 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 67 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 32 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 22 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 44 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 4 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 2 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 17 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 8 22902560 Mili IP Fkbp6 -/-,P10,testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 7 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 15 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 17 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 22 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 6 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 5 20059948 Mili IP Tdrd9-/- 14dpp testis
217 GSM1653802 16 25582079 MIWI CLIP round spermatids
225 GSM1528807 6 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 7 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 15 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 22 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 38 25262350 small RNA E16.5 whole testes
247 GSM1318060 27 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
347 GSM475281 5 20022248 small RNA testis 
348 GSM3772906 13 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 12 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 14 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 5 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 797 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 39 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 112 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 17 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 78 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:3201477-3201505:+ rRNA rRNA SSU-rRNA_Hsa;
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 4.9324
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 1.0308
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 7.7667
Sample CPM
GSM400968 1.9539
GSM400969 11.37
GSM433288 0
GSM433289 0.4375
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0.2378
GSM475279 0
GSM475280 0
GSM475281 0.4691
GSM678422 5.7304
The Expression of piRNA: piR-mmu-192238
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.