Loading...
| piRBase Id | piR-mmu-1917 | Accession | DQ540053 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | ACGATACGGCAGCGCCGAAGGAGCCTCGG | Number of papers | 6 |
| Length | 29 | Golden piRNA | - |
| Aliases | piR-165; PIR1164; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 16 | GSM822763 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 58 | GSM319954 | 1 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
| 217 | GSM1653802 | 34 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 4 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 1 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 4 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 4 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 246 | GSM1318059 | 1 | 25262350 | small RNA | E16.5 whole testes |
| 247 | GSM1318060 | 4 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 16:11144005-11144034:+ | Zc3h7a ENSMUST00000037633; Zc3h7a ENSMUST00000140898; Zc3h7a ENSMUST00000140755; | |
| Location 2 | 17:70963850-70963879:+ | LINE L1 Lx5; LINE L1 L1MA5; | |
| Location 3 | 3:83124117-83124146:- | ||
| Location 4 | 9:56223831-56223860:- | Peak1 ENSMUST00000188142; Peak1 ENSMUST00000061552; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0.4649 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0 |
| GSM433289 | 0 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||