Loading...
piRBase Id | piR-mmu-190766 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TTTAATCCTAGCACTCTGTAGGCAGAAGCA | Number of papers | 4 |
Length | 30 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
11 | GSM822760 | 4 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
13 | GSM822759 | 3 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
52 | GSM610967 | 2 | 21602304 | small RNA | Male germ cell, Round spermatids |
226 | GSM1528808 | 1 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 13:21989036-21989066:+ | LTR ERVK RLTR31D_MM; |
No record. |
No record. |
Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
---|---|---|---|---|---|
NONMMUT002538 | cleavage | mm9 chr1:132619500-132619520:+ | n | N/A |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |