Loading...

Detail Information of piRNA: piR-mmu-190766

General Information
piRBase Id piR-mmu-190766 Accession N/A
Organism Mouse Number of methods 3
Sequence TTTAATCCTAGCACTCTGTAGGCAGAAGCA Number of papers 4
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
13 GSM822759 3 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 13:21989036-21989066:+ LTR ERVK RLTR31D_MM;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
NONMMUT002538 cleavage mm9 chr1:132619500-132619520:+ n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.