Loading...

Detail Information of piRNA: piR-mmu-188208

General Information
piRBase Id piR-mmu-188208 Accession N/A
Organism Mouse Number of methods 4
Sequence TGTGTTTGAATGCTTGGCCATAGGGAGT Number of papers 9
Length 28 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 7 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 13 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 18 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 9 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 53 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 62 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 2 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
117 GSM958038 2 22902560 Mili IP Fkbp6 -/-,P10,testis
132 GSM475279 21 20022248 Miwi IP adult testis
133 GSM475280 11 20022248 Mili IP adult testis
217 GSM1653802 5 25582079 MIWI CLIP round spermatids
225 GSM1528807 38 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 80 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 91 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 76 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 20 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 33 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 35 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 7 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 21 20022248 Miwi-IP testis 
346 GSM475280 11 20022248 Mili-IP testis 
347 GSM475281 12 20022248 small RNA testis 
441 GSM1096582 28 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 144 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 287 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 143 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 167 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 367 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 44 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 34 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 99 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 79 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 40 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 21 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
47 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:33624301-33624329:+ Ubxn8 ENSMUST00000095349; SINE B4 B4A;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.6838
GSM433289 7.2185
GSM433290 7.4331
GSM433291 2.4901
GSM433292 2.4313
GSM433293 3.8284
GSM433294 0
GSM433295 0
GSM475279 2.0171
GSM475280 1.0001
GSM475281 1.1258
GSM678422 0
The Expression of piRNA: piR-mmu-188208
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
4930558J18Rik NR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavage mm9 chr1:57416233-57416253:- n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.