Loading...

Detail Information of piRNA: piR-mmu-1858

General Information
piRBase Id piR-mmu-1858 Accession DQ550475
Organism Mouse Number of methods 4
Sequence TGCCTCTTGGATGTCTGGTACCTGGC Number of papers 8
Length 26 Golden piRNA -
Aliases piR-18587; PIR11586;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
35 GSM684620 81 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 2 22842725 Mili CLIP C57BL/6 adult testis
73 N/A 11 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 2 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 2 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 11 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 4 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 2 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 4 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 3 22020280 Mili IP wild_type_2 E16.5 fetal testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
133 GSM475280 6 20022248 Mili IP adult testis
225 GSM1528807 2 26588211 small RNA Adult testes Asb1 ao31(Het)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 2 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
346 GSM475280 6 20022248 Mili-IP testis 
347 GSM475281 1 20022248 small RNA testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 15 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 4 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 40 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 46 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 7 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 6 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:87979925-87979951:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.3107
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 0.4684
GSM433289 0.2187
GSM433290 0.2124
GSM433291 0
GSM433292 0
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.5455
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-1858
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.