Loading...

Detail Information of piRNA: piR-mmu-185049

General Information
piRBase Id piR-mmu-185049 Accession N/A
Organism Mouse Number of methods 3
Sequence TGATGCTGGCAAGGGAGAATCGAATATGGT Number of papers 7
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 52 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 3 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
51 GSM610966 6 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
132 GSM475279 10 20022248 Miwi IP adult testis
133 GSM475280 4 20022248 Mili IP adult testis
225 GSM1528807 50 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 81 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 44 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 56 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 4 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 30 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 21 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 3 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 10 20022248 Miwi-IP testis 
346 GSM475280 4 20022248 Mili-IP testis 
347 GSM475281 14 20022248 small RNA testis 
356 GSM4635229 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
445 GSM1096584 2 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 9 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 5 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 3 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 9 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 7 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 6 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 7:69931730-69931760:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.9368
GSM433289 6.5622
GSM433290 4.4598
GSM433291 1.0672
GSM433292 5.3488
GSM433293 4.6792
GSM433294 0
GSM433295 0
GSM475279 0.9605
GSM475280 0.3637
GSM475281 1.3134
GSM678422 0
The Expression of piRNA: piR-mmu-185049
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.