Loading...

Detail Information of piRNA: piR-mmu-1841

General Information
piRBase Id piR-mmu-1841 Accession DQ704285
Organism Mouse Number of methods 5
Sequence TGCCTCTGAGAATGTGATACTGCTGTC Number of papers 14
Length 27 Golden piRNA Y
Aliases piR-18571; piR-119607; PIR11570; PIR212933;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 2 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
35 GSM684620 90 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 118 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 1 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 27 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 2 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 4 21602304 small RNA Male germ cell, Round spermatids
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
76 N/A 2 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
132 GSM475279 5 20022248 Miwi IP adult testis
133 GSM475280 371 20022248 Mili IP adult testis
217 GSM1653802 5 25582079 MIWI CLIP round spermatids
225 GSM1528807 119 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 127 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 164 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 147 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 106 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 273 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 210 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 102 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 5 20022248 Miwi-IP testis 
346 GSM475280 371 20022248 Mili-IP testis 
347 GSM475281 70 20022248 small RNA testis 
441 GSM1096582 19 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 47 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 43 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 44 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 94 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 115 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 27 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 72 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 104 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 214 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 87 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 105 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
3 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:34601466-34601493:+ Simple_repeat Simple_repeat (TTTC)n;
Location 2 17:66154293-66154320:- Simple_repeat Simple_repeat (TG)n;
Location 3 17:66207896-66207923:+ SINE B4 B4A;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 24.824
GSM433289 59.7163
GSM433290 44.5985
GSM433291 36.2842
GSM433292 42.0612
GSM433293 27.2244
GSM433294 0
GSM433295 0
GSM475279 0.4803
GSM475280 33.7314
GSM475281 6.5669
GSM678422 0
The Expression of piRNA: piR-mmu-1841
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.