Loading...

Detail Information of piRNA: piR-mmu-1820

General Information
piRBase Id piR-mmu-1820 Accession DQ708010
Organism Mouse Number of methods 5
Sequence TGCCTCGCCCTGTGATGTGTCATGCTG Number of papers 8
Length 27 Golden piRNA -
Aliases piR-18552; piR-123332; PIR11551; PIR216658;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
37 GSM684622 4 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 4 22842725 Mili CLIP C57BL/6 adult testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
225 GSM1528807 5 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 9 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 8 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 7 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 3 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 3 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 5 26115953 small RNA 25dpp hetero tdrd6 KO testes
443 GSM1096583 11 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 19 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 36 23523368 oxidized small RNA Wild Type 14.5 dpp testes
449 GSM1096586 12 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 5 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:62224603-62224630:- Zfp37 ENSMUST00000212325;
Location 2 4:62234900-62234927:+ LTR ERVL-MaLR ORR1B1;
piRNA Expression
The Expression of piRNA: piR-mmu-1820
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.