Loading...
piRBase Id | piR-mmu-1820 | Accession | DQ708010 |
---|---|---|---|
Organism | Mouse | Number of methods | 5 |
Sequence | TGCCTCGCCCTGTGATGTGTCATGCTG | Number of papers | 8 |
Length | 27 | Golden piRNA | - |
Aliases | piR-18552; piR-123332; PIR11551; PIR216658; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
6 | GSM113695 | 1 | 16778019 | Chromatography | testes tissue from Swiss Webster male mice, 8-10 weeks old |
16 | GSM822763 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
37 | GSM684622 | 4 | 22842725 | Mili CLIP | C57BL/6 adult testis |
38 | GSM684623 | 4 | 22842725 | Mili CLIP | C57BL/6 adult testis |
115 | GSM958036 | 1 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
225 | GSM1528807 | 5 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 9 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 8 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 7 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 3 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 3 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 5 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
443 | GSM1096583 | 11 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 19 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 36 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
449 | GSM1096586 | 12 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 5 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 4:62224603-62224630:- | Zfp37 ENSMUST00000212325; | |
Location 2 | 4:62234900-62234927:+ | LTR ERVL-MaLR ORR1B1; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0.7026 |
GSM433289 | 0.6562 |
GSM433290 | 1.0619 |
GSM433291 | 0 |
GSM433292 | 0.9725 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 16778019 | Journal | Science. 2006 Jul 21;313(5785):363-7. |
---|---|---|---|
Title | Characterization of the piRNA complex from rat testes. | ||
Authors | Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |