Loading...

Detail Information of piRNA: piR-mmu-18027

General Information
piRBase Id piR-mmu-18027 Accession DQ540862
Organism Mouse Number of methods 3
Sequence CCGGGTGATGCGAATCGTAATCTGAGCCGA Number of papers 11
Length 30 Golden piRNA -
Aliases piR-974; PIR1973;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
50 GSM610965 2 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 14 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 15 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 24 18922463 small RNA 16.5 dpc testis
62 GSM319958 709 18922463 small RNA 4-6 week ovary
73 N/A 10 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 23 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 5 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 21 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 1 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
78 N/A 4 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
81 N/A 27 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 40 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 19 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 5 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 49 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 13 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 15 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 26 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
122 N/A 639 21515829 small RNA hippocampus
225 GSM1528807 24 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 31 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 29 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 45 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 9 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 16 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 7 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 6 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 161 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 116 25262350 small RNA E16.5 whole testes
247 GSM1318060 88 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
348 GSM3772906 174 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 177 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 345 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 186 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 198 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 182 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 28 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 101 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 262 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1087 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 89 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 24 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 52 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 26 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 11:106501035-106501065:+ Snord104 ENSMUST00000083192; LTR ERVL-MaLR ORR1B1-int; SINE Alu B1_Mus1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 28.7724
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 14.5635
GSM319956 0
GSM319957 0
GSM319958 1142.4465
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 2.1077
GSM433289 3.4999
GSM433290 1.4866
GSM433291 0.3557
GSM433292 1.4588
GSM433293 0.4254
GSM433294 37.7787
GSM433295 9.0378
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 3.608
The Expression of piRNA: piR-mmu-18027
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 21515829 Journal RNA. 2011 Jun;17(6):1090-9.
Title Identification of piRNAs in the central nervous system.
Authors Lee EJ, Banerjee S, Zhou H, Jammalamadaka A, Arcila M, Manjunath BS, Kosik KS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.