Loading...

Detail Information of piRNA: piR-mmu-1722

General Information
piRBase Id piR-mmu-1722 Accession DQ695051
Organism Mouse Number of methods 4
Sequence TAAAAAGAGAACTACCACCTCATTTCCGTGT Number of papers 8
Length 31 Golden piRNA -
Aliases piR-2107; piR-110373; PIR13106; PIR203699;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 5 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
31 GSM684624 39 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 49 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 32 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 21 22842725 Miwi CLIP C57BL/6 adult testis
217 GSM1653802 22 25582079 MIWI CLIP round spermatids
225 GSM1528807 41 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 92 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 83 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 96 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 59 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 26 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 193 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 95 26115953 small RNA 25dpp homo tdrd6 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
441 GSM1096582 8 23523368 small RNA Wild Type 10.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 91 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 42 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 148 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 93 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 229 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 222 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 520 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:54238013-54238044:- Cyp19a1 ENSMUST00000214358; LINE L1 L1M5;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 13.8172
GSM433289 5.6873
GSM433290 40.9881
GSM433291 33.7941
GSM433292 86.0674
GSM433293 55.7249
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.1592
The Expression of piRNA: piR-mmu-1722
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.